Review



filter supports avanti polar lipids  (Croda International Plc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Croda International Plc filter supports avanti polar lipids
    Filter Supports Avanti Polar Lipids, supplied by Croda International Plc, used in various techniques. Bioz Stars score: 94/100, based on 84 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/filter+supports+avanti+polar+lipids/Filter+Support/pm41790551-187-141-143
    Average 94 stars, based on 84 article reviews
    filter supports avanti polar lipids - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Chromatography:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other PD MiniTrap desalting columns with Sephadex G-25 resin Cytiva Cat#: 28918007 Ni Sepharose 6 Fast Flow resin Cytiva Cat#: 17531801 Glass chromatography column Bio-rad N/A 10% TBE-Urea gel Invitrogen Cat#: EC6875BOX 6% Tris-glycine protein gel Invitrogen Cat#: XP00060BOX UV-visible spectrophotometer Agilent Cat#: 8453 G1103A Microvolume spectrophotometer Thermo Scientific Nanodrop 2000 Ultracentrifuge Beckman Coulter Optima L-80 XP Ultracentrifuge rotor Beckman Coulter Type 50.2 Ti Thickwall polypropylene tubes Beckman Coulter Cat#: 355644 Acetal adapter Beckman Coulter Cat#: 303392 Airfuge Beckman Coulter Cat#: 350624 Fixed-angle airfuge rotor Beckman Coulter A-100/18 Open-top thinwall polypropylene tube, 5 3 20 mm Beckman Coulter Cat#: 342630 Plate reader Molecular Devices FlexStation3 R 96-well assay plate Corning Cat#: 3603 Self-cleaning Dry Vacuum System Welch 2025 Rotary Evaporator Heidolph Collegiate Glassware set for Rotary Evaporator Heidolph G1 Mini-extruder Avanti Polar Lipids Cat#: 610000 Filter Supports Avanti Polar Lipids Cat#: 610014 Polycarbonate Membranes 0.1 μm Avanti Polar Lipids Cat#: 610005 100 μL Gastight syringe model 1710 N Hamilton Cat#: 81000 500 μL Microliter syringe model 750 N, point style 2 Hamilton Cat#: 80800 500 μL Microliter syringe model 750 N, point style 3 Hamilton Cat#: 80865 Coverslips, #1.5, 18 3 18 mm Corning Cat#: 2845-18 Ceramic coverslip holders N/A N/A Plasma Cleaner Harrick Plasma PDC-32G Vacuum desiccator N/A N/A Integrated multi-wavelength Microscope combining TIRFM and IRM modalities Nong et al 5 N/A Lysis Buffer for Purification with Ni Resin Reagent Final concentration Amount NaH 2 PO 4 ⋅H 2 O 50 mM 6.9 g NaCl 300 mM 17.52 g Imidazole 40 mM 2.72 g MgCl 2 (2 M) 1 mM 0.5 mL ddH 2 O N/A To 1 L Total N/A 1 L Use NaOH to adjust pH to 8.0. ..

    Spectrophotometry:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other PD MiniTrap desalting columns with Sephadex G-25 resin Cytiva Cat#: 28918007 Ni Sepharose 6 Fast Flow resin Cytiva Cat#: 17531801 Glass chromatography column Bio-rad N/A 10% TBE-Urea gel Invitrogen Cat#: EC6875BOX 6% Tris-glycine protein gel Invitrogen Cat#: XP00060BOX UV-visible spectrophotometer Agilent Cat#: 8453 G1103A Microvolume spectrophotometer Thermo Scientific Nanodrop 2000 Ultracentrifuge Beckman Coulter Optima L-80 XP Ultracentrifuge rotor Beckman Coulter Type 50.2 Ti Thickwall polypropylene tubes Beckman Coulter Cat#: 355644 Acetal adapter Beckman Coulter Cat#: 303392 Airfuge Beckman Coulter Cat#: 350624 Fixed-angle airfuge rotor Beckman Coulter A-100/18 Open-top thinwall polypropylene tube, 5 3 20 mm Beckman Coulter Cat#: 342630 Plate reader Molecular Devices FlexStation3 R 96-well assay plate Corning Cat#: 3603 Self-cleaning Dry Vacuum System Welch 2025 Rotary Evaporator Heidolph Collegiate Glassware set for Rotary Evaporator Heidolph G1 Mini-extruder Avanti Polar Lipids Cat#: 610000 Filter Supports Avanti Polar Lipids Cat#: 610014 Polycarbonate Membranes 0.1 μm Avanti Polar Lipids Cat#: 610005 100 μL Gastight syringe model 1710 N Hamilton Cat#: 81000 500 μL Microliter syringe model 750 N, point style 2 Hamilton Cat#: 80800 500 μL Microliter syringe model 750 N, point style 3 Hamilton Cat#: 80865 Coverslips, #1.5, 18 3 18 mm Corning Cat#: 2845-18 Ceramic coverslip holders N/A N/A Plasma Cleaner Harrick Plasma PDC-32G Vacuum desiccator N/A N/A Integrated multi-wavelength Microscope combining TIRFM and IRM modalities Nong et al 5 N/A Lysis Buffer for Purification with Ni Resin Reagent Final concentration Amount NaH 2 PO 4 ⋅H 2 O 50 mM 6.9 g NaCl 300 mM 17.52 g Imidazole 40 mM 2.72 g MgCl 2 (2 M) 1 mM 0.5 mL ddH 2 O N/A To 1 L Total N/A 1 L Use NaOH to adjust pH to 8.0. ..

    Clinical Proteomics:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other PD MiniTrap desalting columns with Sephadex G-25 resin Cytiva Cat#: 28918007 Ni Sepharose 6 Fast Flow resin Cytiva Cat#: 17531801 Glass chromatography column Bio-rad N/A 10% TBE-Urea gel Invitrogen Cat#: EC6875BOX 6% Tris-glycine protein gel Invitrogen Cat#: XP00060BOX UV-visible spectrophotometer Agilent Cat#: 8453 G1103A Microvolume spectrophotometer Thermo Scientific Nanodrop 2000 Ultracentrifuge Beckman Coulter Optima L-80 XP Ultracentrifuge rotor Beckman Coulter Type 50.2 Ti Thickwall polypropylene tubes Beckman Coulter Cat#: 355644 Acetal adapter Beckman Coulter Cat#: 303392 Airfuge Beckman Coulter Cat#: 350624 Fixed-angle airfuge rotor Beckman Coulter A-100/18 Open-top thinwall polypropylene tube, 5 3 20 mm Beckman Coulter Cat#: 342630 Plate reader Molecular Devices FlexStation3 R 96-well assay plate Corning Cat#: 3603 Self-cleaning Dry Vacuum System Welch 2025 Rotary Evaporator Heidolph Collegiate Glassware set for Rotary Evaporator Heidolph G1 Mini-extruder Avanti Polar Lipids Cat#: 610000 Filter Supports Avanti Polar Lipids Cat#: 610014 Polycarbonate Membranes 0.1 μm Avanti Polar Lipids Cat#: 610005 100 μL Gastight syringe model 1710 N Hamilton Cat#: 81000 500 μL Microliter syringe model 750 N, point style 2 Hamilton Cat#: 80800 500 μL Microliter syringe model 750 N, point style 3 Hamilton Cat#: 80865 Coverslips, #1.5, 18 3 18 mm Corning Cat#: 2845-18 Ceramic coverslip holders N/A N/A Plasma Cleaner Harrick Plasma PDC-32G Vacuum desiccator N/A N/A Integrated multi-wavelength Microscope combining TIRFM and IRM modalities Nong et al 5 N/A Lysis Buffer for Purification with Ni Resin Reagent Final concentration Amount NaH 2 PO 4 ⋅H 2 O 50 mM 6.9 g NaCl 300 mM 17.52 g Imidazole 40 mM 2.72 g MgCl 2 (2 M) 1 mM 0.5 mL ddH 2 O N/A To 1 L Total N/A 1 L Use NaOH to adjust pH to 8.0. ..

    Article Title: Protocol to engineer nanofilms embedded lipid nanoparticles for controlled and targeted drug delivery (NECTAR).
    Article Snippet: 15,000–30,000) MilliporeSigma Cat# 26124-78-7 y(sodium 4-styrene sulfonate) (SPS) (M.W. .. 70,000) MilliporeSigma Cat# 25704-18-1 (Continued on next page) STAR Protocols 4, 101685, March 17, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Hyaluronic acid (HA) MilliporeSigma Cat# 53747 1, 2- Dipalmitoyl-sn-glycero-3phopshoethanolamine (DPPE) MilliporeSigma Cat# P1348 Cholesterol (CHOL) MilliporeSigma Cat# C8667 1-ethyl-3-(3-dimethylaminopropyl) carbomiide (EDAC) MilliporeSigma Cat# 341006 L a-Phosphatidylcholine (PC) MilliporeSigma Cat# P3556 TopFluor cholesterol Avanti Polar Lipids Cat# 810255 Boric acid (H3BO3) Sigma-Aldrich Cat# B6768 Glacial acetic acid (CH3COOH) Sigma-Aldrich Cat# PHR1748 HEPES free acid (C8H18N2O4S) Sigma-Aldrich Cat# 391338 Sodium acetate (CH3COONa) Sigma-Aldrich Cat# S2889 Sodium chloride (NaCl) Sigma-Aldrich Cat# S9888 Potassium chloride (KCl) Sigma-Aldrich Cat# P3911 Sodium phosphate dibasic (Na2HPO4) Sigma-Aldrich Cat# 94046 Potassium phosphate monobasic (KH2PO4) Sigma-Aldrich Cat# P8709 MES (2-[morpholino]ethanesulfonic acid) Sigma-Aldrich Cat# M3671 Hydroxylamine-HCl Thermo Fisher Scientific Cat# 26103 Sulfo-NHS (N-hydroxysulfosuccinimide) Thermo Fisher Scientific Cat# 24510 100% Pure ethanol (200 Proof) Decon Labs Cat# 2701 Software and algorithms ImageJ N/A N/A Photoshop N/A N/A Biorender N/A N/A Other Syringe Sigma-Aldrich Cat# Z116866-100EA Syringe filter Sigma-Aldrich Cat# WHA10462200 Mini extruder apparatus Avanti Polar Lipids Cat# 610020 Polycarbonate membranes 0.8 mm Avanti Polar Lipids Cat# 610009 Polycarbonate membranes 0.4 mm Avanti Polar Lipids Cat# 610007 Polycarbonate membranes 0.2 mm Avanti Polar Lipids Cat# 610006 Polycarbonate membranes 0.08 mm Avanti Polar Lipids Cat# 610005 Filter supports Avanti Polar Lipids Cat# 610014 Heating plate (model: Isotemp) Fisher Scientific N/A Ultracentrifuge (model: Optima Max-XP) Beckman Coulter Life Sciences Cat# 393315 Ultracentrifuge rotor (model: TLA-100.3) Beckman Coulter Life Sciences Cat# 349490 Ultracentrifuge tubes (3.5 mL tubes for TLA-100.3 rotor) Beckman Coulter Life Sciences Cat# 349622 Rotary evaporator (model: Rotavapor R-124) BUCHI Cat# R-124 Inverted microscope (model: Axiovert 40 CFL) ZEISS N/A Microscope camera (model: ProgRes C3) Jenoptik N/A Plasma cleaner (model: High Power Expanded Plasma Cleaner) Harrick Plasma Cat# PDC-001-HP Ultrasonic bath (model: FS30D Ultrasonic Cleaner) Fisher Scientific N/A Vortex (model: Maxi Mix II Vortex Mixer) Fisher Scientific Cat# NC0453190 ll OPEN ACCESSProtocol ..

    Microscopy:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other PD MiniTrap desalting columns with Sephadex G-25 resin Cytiva Cat#: 28918007 Ni Sepharose 6 Fast Flow resin Cytiva Cat#: 17531801 Glass chromatography column Bio-rad N/A 10% TBE-Urea gel Invitrogen Cat#: EC6875BOX 6% Tris-glycine protein gel Invitrogen Cat#: XP00060BOX UV-visible spectrophotometer Agilent Cat#: 8453 G1103A Microvolume spectrophotometer Thermo Scientific Nanodrop 2000 Ultracentrifuge Beckman Coulter Optima L-80 XP Ultracentrifuge rotor Beckman Coulter Type 50.2 Ti Thickwall polypropylene tubes Beckman Coulter Cat#: 355644 Acetal adapter Beckman Coulter Cat#: 303392 Airfuge Beckman Coulter Cat#: 350624 Fixed-angle airfuge rotor Beckman Coulter A-100/18 Open-top thinwall polypropylene tube, 5 3 20 mm Beckman Coulter Cat#: 342630 Plate reader Molecular Devices FlexStation3 R 96-well assay plate Corning Cat#: 3603 Self-cleaning Dry Vacuum System Welch 2025 Rotary Evaporator Heidolph Collegiate Glassware set for Rotary Evaporator Heidolph G1 Mini-extruder Avanti Polar Lipids Cat#: 610000 Filter Supports Avanti Polar Lipids Cat#: 610014 Polycarbonate Membranes 0.1 μm Avanti Polar Lipids Cat#: 610005 100 μL Gastight syringe model 1710 N Hamilton Cat#: 81000 500 μL Microliter syringe model 750 N, point style 2 Hamilton Cat#: 80800 500 μL Microliter syringe model 750 N, point style 3 Hamilton Cat#: 80865 Coverslips, #1.5, 18 3 18 mm Corning Cat#: 2845-18 Ceramic coverslip holders N/A N/A Plasma Cleaner Harrick Plasma PDC-32G Vacuum desiccator N/A N/A Integrated multi-wavelength Microscope combining TIRFM and IRM modalities Nong et al 5 N/A Lysis Buffer for Purification with Ni Resin Reagent Final concentration Amount NaH 2 PO 4 ⋅H 2 O 50 mM 6.9 g NaCl 300 mM 17.52 g Imidazole 40 mM 2.72 g MgCl 2 (2 M) 1 mM 0.5 mL ddH 2 O N/A To 1 L Total N/A 1 L Use NaOH to adjust pH to 8.0. ..

    Article Title: Protocol to engineer nanofilms embedded lipid nanoparticles for controlled and targeted drug delivery (NECTAR).
    Article Snippet: 15,000–30,000) MilliporeSigma Cat# 26124-78-7 y(sodium 4-styrene sulfonate) (SPS) (M.W. .. 70,000) MilliporeSigma Cat# 25704-18-1 (Continued on next page) STAR Protocols 4, 101685, March 17, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Hyaluronic acid (HA) MilliporeSigma Cat# 53747 1, 2- Dipalmitoyl-sn-glycero-3phopshoethanolamine (DPPE) MilliporeSigma Cat# P1348 Cholesterol (CHOL) MilliporeSigma Cat# C8667 1-ethyl-3-(3-dimethylaminopropyl) carbomiide (EDAC) MilliporeSigma Cat# 341006 L a-Phosphatidylcholine (PC) MilliporeSigma Cat# P3556 TopFluor cholesterol Avanti Polar Lipids Cat# 810255 Boric acid (H3BO3) Sigma-Aldrich Cat# B6768 Glacial acetic acid (CH3COOH) Sigma-Aldrich Cat# PHR1748 HEPES free acid (C8H18N2O4S) Sigma-Aldrich Cat# 391338 Sodium acetate (CH3COONa) Sigma-Aldrich Cat# S2889 Sodium chloride (NaCl) Sigma-Aldrich Cat# S9888 Potassium chloride (KCl) Sigma-Aldrich Cat# P3911 Sodium phosphate dibasic (Na2HPO4) Sigma-Aldrich Cat# 94046 Potassium phosphate monobasic (KH2PO4) Sigma-Aldrich Cat# P8709 MES (2-[morpholino]ethanesulfonic acid) Sigma-Aldrich Cat# M3671 Hydroxylamine-HCl Thermo Fisher Scientific Cat# 26103 Sulfo-NHS (N-hydroxysulfosuccinimide) Thermo Fisher Scientific Cat# 24510 100% Pure ethanol (200 Proof) Decon Labs Cat# 2701 Software and algorithms ImageJ N/A N/A Photoshop N/A N/A Biorender N/A N/A Other Syringe Sigma-Aldrich Cat# Z116866-100EA Syringe filter Sigma-Aldrich Cat# WHA10462200 Mini extruder apparatus Avanti Polar Lipids Cat# 610020 Polycarbonate membranes 0.8 mm Avanti Polar Lipids Cat# 610009 Polycarbonate membranes 0.4 mm Avanti Polar Lipids Cat# 610007 Polycarbonate membranes 0.2 mm Avanti Polar Lipids Cat# 610006 Polycarbonate membranes 0.08 mm Avanti Polar Lipids Cat# 610005 Filter supports Avanti Polar Lipids Cat# 610014 Heating plate (model: Isotemp) Fisher Scientific N/A Ultracentrifuge (model: Optima Max-XP) Beckman Coulter Life Sciences Cat# 393315 Ultracentrifuge rotor (model: TLA-100.3) Beckman Coulter Life Sciences Cat# 349490 Ultracentrifuge tubes (3.5 mL tubes for TLA-100.3 rotor) Beckman Coulter Life Sciences Cat# 349622 Rotary evaporator (model: Rotavapor R-124) BUCHI Cat# R-124 Inverted microscope (model: Axiovert 40 CFL) ZEISS N/A Microscope camera (model: ProgRes C3) Jenoptik N/A Plasma cleaner (model: High Power Expanded Plasma Cleaner) Harrick Plasma Cat# PDC-001-HP Ultrasonic bath (model: FS30D Ultrasonic Cleaner) Fisher Scientific N/A Vortex (model: Maxi Mix II Vortex Mixer) Fisher Scientific Cat# NC0453190 ll OPEN ACCESSProtocol ..

    Lysis:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other PD MiniTrap desalting columns with Sephadex G-25 resin Cytiva Cat#: 28918007 Ni Sepharose 6 Fast Flow resin Cytiva Cat#: 17531801 Glass chromatography column Bio-rad N/A 10% TBE-Urea gel Invitrogen Cat#: EC6875BOX 6% Tris-glycine protein gel Invitrogen Cat#: XP00060BOX UV-visible spectrophotometer Agilent Cat#: 8453 G1103A Microvolume spectrophotometer Thermo Scientific Nanodrop 2000 Ultracentrifuge Beckman Coulter Optima L-80 XP Ultracentrifuge rotor Beckman Coulter Type 50.2 Ti Thickwall polypropylene tubes Beckman Coulter Cat#: 355644 Acetal adapter Beckman Coulter Cat#: 303392 Airfuge Beckman Coulter Cat#: 350624 Fixed-angle airfuge rotor Beckman Coulter A-100/18 Open-top thinwall polypropylene tube, 5 3 20 mm Beckman Coulter Cat#: 342630 Plate reader Molecular Devices FlexStation3 R 96-well assay plate Corning Cat#: 3603 Self-cleaning Dry Vacuum System Welch 2025 Rotary Evaporator Heidolph Collegiate Glassware set for Rotary Evaporator Heidolph G1 Mini-extruder Avanti Polar Lipids Cat#: 610000 Filter Supports Avanti Polar Lipids Cat#: 610014 Polycarbonate Membranes 0.1 μm Avanti Polar Lipids Cat#: 610005 100 μL Gastight syringe model 1710 N Hamilton Cat#: 81000 500 μL Microliter syringe model 750 N, point style 2 Hamilton Cat#: 80800 500 μL Microliter syringe model 750 N, point style 3 Hamilton Cat#: 80865 Coverslips, #1.5, 18 3 18 mm Corning Cat#: 2845-18 Ceramic coverslip holders N/A N/A Plasma Cleaner Harrick Plasma PDC-32G Vacuum desiccator N/A N/A Integrated multi-wavelength Microscope combining TIRFM and IRM modalities Nong et al 5 N/A Lysis Buffer for Purification with Ni Resin Reagent Final concentration Amount NaH 2 PO 4 ⋅H 2 O 50 mM 6.9 g NaCl 300 mM 17.52 g Imidazole 40 mM 2.72 g MgCl 2 (2 M) 1 mM 0.5 mL ddH 2 O N/A To 1 L Total N/A 1 L Use NaOH to adjust pH to 8.0. ..

    Purification:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other PD MiniTrap desalting columns with Sephadex G-25 resin Cytiva Cat#: 28918007 Ni Sepharose 6 Fast Flow resin Cytiva Cat#: 17531801 Glass chromatography column Bio-rad N/A 10% TBE-Urea gel Invitrogen Cat#: EC6875BOX 6% Tris-glycine protein gel Invitrogen Cat#: XP00060BOX UV-visible spectrophotometer Agilent Cat#: 8453 G1103A Microvolume spectrophotometer Thermo Scientific Nanodrop 2000 Ultracentrifuge Beckman Coulter Optima L-80 XP Ultracentrifuge rotor Beckman Coulter Type 50.2 Ti Thickwall polypropylene tubes Beckman Coulter Cat#: 355644 Acetal adapter Beckman Coulter Cat#: 303392 Airfuge Beckman Coulter Cat#: 350624 Fixed-angle airfuge rotor Beckman Coulter A-100/18 Open-top thinwall polypropylene tube, 5 3 20 mm Beckman Coulter Cat#: 342630 Plate reader Molecular Devices FlexStation3 R 96-well assay plate Corning Cat#: 3603 Self-cleaning Dry Vacuum System Welch 2025 Rotary Evaporator Heidolph Collegiate Glassware set for Rotary Evaporator Heidolph G1 Mini-extruder Avanti Polar Lipids Cat#: 610000 Filter Supports Avanti Polar Lipids Cat#: 610014 Polycarbonate Membranes 0.1 μm Avanti Polar Lipids Cat#: 610005 100 μL Gastight syringe model 1710 N Hamilton Cat#: 81000 500 μL Microliter syringe model 750 N, point style 2 Hamilton Cat#: 80800 500 μL Microliter syringe model 750 N, point style 3 Hamilton Cat#: 80865 Coverslips, #1.5, 18 3 18 mm Corning Cat#: 2845-18 Ceramic coverslip holders N/A N/A Plasma Cleaner Harrick Plasma PDC-32G Vacuum desiccator N/A N/A Integrated multi-wavelength Microscope combining TIRFM and IRM modalities Nong et al 5 N/A Lysis Buffer for Purification with Ni Resin Reagent Final concentration Amount NaH 2 PO 4 ⋅H 2 O 50 mM 6.9 g NaCl 300 mM 17.52 g Imidazole 40 mM 2.72 g MgCl 2 (2 M) 1 mM 0.5 mL ddH 2 O N/A To 1 L Total N/A 1 L Use NaOH to adjust pH to 8.0. ..

    Concentration Assay:

    Article Title: Protocol to reconstitute motor protein clustering on vesicle membranes using a DNA scaffold-based system in vitro.
    Article Snippet: .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Other PD MiniTrap desalting columns with Sephadex G-25 resin Cytiva Cat#: 28918007 Ni Sepharose 6 Fast Flow resin Cytiva Cat#: 17531801 Glass chromatography column Bio-rad N/A 10% TBE-Urea gel Invitrogen Cat#: EC6875BOX 6% Tris-glycine protein gel Invitrogen Cat#: XP00060BOX UV-visible spectrophotometer Agilent Cat#: 8453 G1103A Microvolume spectrophotometer Thermo Scientific Nanodrop 2000 Ultracentrifuge Beckman Coulter Optima L-80 XP Ultracentrifuge rotor Beckman Coulter Type 50.2 Ti Thickwall polypropylene tubes Beckman Coulter Cat#: 355644 Acetal adapter Beckman Coulter Cat#: 303392 Airfuge Beckman Coulter Cat#: 350624 Fixed-angle airfuge rotor Beckman Coulter A-100/18 Open-top thinwall polypropylene tube, 5 3 20 mm Beckman Coulter Cat#: 342630 Plate reader Molecular Devices FlexStation3 R 96-well assay plate Corning Cat#: 3603 Self-cleaning Dry Vacuum System Welch 2025 Rotary Evaporator Heidolph Collegiate Glassware set for Rotary Evaporator Heidolph G1 Mini-extruder Avanti Polar Lipids Cat#: 610000 Filter Supports Avanti Polar Lipids Cat#: 610014 Polycarbonate Membranes 0.1 μm Avanti Polar Lipids Cat#: 610005 100 μL Gastight syringe model 1710 N Hamilton Cat#: 81000 500 μL Microliter syringe model 750 N, point style 2 Hamilton Cat#: 80800 500 μL Microliter syringe model 750 N, point style 3 Hamilton Cat#: 80865 Coverslips, #1.5, 18 3 18 mm Corning Cat#: 2845-18 Ceramic coverslip holders N/A N/A Plasma Cleaner Harrick Plasma PDC-32G Vacuum desiccator N/A N/A Integrated multi-wavelength Microscope combining TIRFM and IRM modalities Nong et al 5 N/A Lysis Buffer for Purification with Ni Resin Reagent Final concentration Amount NaH 2 PO 4 ⋅H 2 O 50 mM 6.9 g NaCl 300 mM 17.52 g Imidazole 40 mM 2.72 g MgCl 2 (2 M) 1 mM 0.5 mL ddH 2 O N/A To 1 L Total N/A 1 L Use NaOH to adjust pH to 8.0. ..

    other:

    Article Title: Structural insights into pre-pore intermediates of alpha-hemolysin in the lipidic environment
    Article Snippet: REAGENT SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli BL21(DE3) Novagen Cat# 69450-3CN Chemicals, peptides, and recombinant proteins Tris Base HiMedia Cat# TC072M Sodium Chloride Qualigens Cat# Q15918 Potassium Chloride Merck Cat# P3911 Potassium di-hydrogen orthophosphate Qualigens Cat# Q19465 Di-sodium hydrogen orthophosphate SD Fine Chemicals Cat# S40158 K05 Luria Broth HiMedia Cat# M575 Isopropyl ß-D-1-thiogalactopyranoside Merck Cat# I6758 Imidazole Sigma Aldrich Cat# 792527-500G 2-Methyl-2,4-pentanediol Sigma Aldrich Cat# 8208190100 L-α-phosphatidylcholine (Egg, Chicken) Avanti Polar Lipids Cat# 840051P-200mg Cholesterol Merck Millipore Cat# C8997-5G Ni-NTA Agarose Qiagen Cat# 30210 Coomassie Brilliant blue R 250 Merck Cat# 1.12553 Precision Plus ProteinTM Dual Color Standards Bio-Rad Cat# #1610374 Amicon Ultra-4 Centrifugal filter unit (10K) Merck Cat# UFC801024 PC Membranes 0.2μm Avanti Polar Lipids Cat# 610006-1EA PC Membranes 1μm Avanti Polar Lipids Cat# 610010-1EA 10mm Filter Supports Avanti Polar Lipids Cat# 610014-1EA Extruder Set with Holder/Heating Block Avanti Polar Lipids Cat# 610000-1EA Syringe (1000 μL) Avanti Polar Lipids Cat# 610017-1EA DSPE-PEG (2000) Biotin Avanti Polar Lipids Cat#880129P-10mg Brain SM Avanti Polar Lipids Cat#860062P-25mg 10:0 PC Avanti Polar Lipids Cat#853025P-25mg 14:0 PC (DMPC) Avanti Polar Lipids Cat#850345C-500mg 16:0 PC (DPPC) Avanti Polar Lipids Cat#850355C-500mg 18:1(Δ9-Cis) PC (DOPC) Avanti Polar Lipids Cat#850375P-1g Rhodamine B Sigma-Aldrich Cat#83689-1G Nile-Red Sigma-Aldrich Cat#72485-100MG 4ME 16:0 NBD PE (NBD-DPhPE) Avanti Polar Lipids Cat#810142C-1mg Streptavidin Egg Liss Rhod PE Avanti Polar Lipids Cat#810146C-5mg Egg PC Avanti Polar Lipids Cat#131601P-5g 12:0 PC Avanti Polar Lipids Cat#850335C-25mg Uranyl Acetate 98%, ACS Reagent Polysciences, Inc Cat# 21447-25 Superdex 200 Increase 10/300 GL Cytiva Cat# GE28-9909-44 EM grid (Carbon film 300 mesh, Copper) Electron Microscopy Sciences Cat# CF300-CU EM grid (Quantifoil R 1.2/1.3 300 Mesh, Copper) Electron Microscopy Sciences Cat# Q3100CR1.3 Quantifoil R 1.2/1.3, UT, 300 Mesh, Copper Electron Microscopy Sciences Cat# Q3100CR1.32nm 4',6-diamidino-2-phenylindole Thermofisher Scientific Cat#D1306 Atto 647N Maleimide Sigma Aldrich Cat#05316 Streptavidin Sisco Research Laboratories Cat#87610

    Article Title: Cryo-EM-based structural insights into supramolecular assemblies of γ-hemolysin from S. aureus reveal the pore formation mechanism.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli BL21(DE3) Novagen Cat# 69450-3CN Chemicals, peptides, and recombinant proteins Tris Base HiMedia Cat# TC072M Sodium Chloride Qualigens Cat# Q15918 Potassium Chloride Merck Cat# P3911 Potassium di-hydrogen orthophosphate Qualigens Cat# Q19465 Di-sodium hydrogen orthophosphate SD Fine Chemicals Cat# S40158 K05 Luria Broth HiMedia Cat# M575 Isopropyl ß-D-1-thiogalactopyranoside Merck Cat# I6758 Imidazole Sigma Aldrich Cat# 792527-500G 2-Methyl-2,4-pentanediol Sigma Aldrich Cat# 8208190100 L-a-phosphatidylcholine (Egg, Chicken) Avanti Polar Lipids Cat# 840051P-200MG Cholesterol Merck Millipore Cat# C8997-5G Ni-NTA Agarose Qiagen Cat# 30210 Coomassie Brilliant blue R 250 Merck Cat# 1.12553 Precision Plus Protein Dual Color Standards Bio-Rad Cat# #1610374 Amicon Ultra-4 Centrifugal filter unit (10K) Merck Cat# UFC801024 PC Membranes 0.2mm Avanti Polar Lipids Cat# 610006-1EA 10mm Filter Supports Avanti Polar Lipids Cat# 610014-1EA Extruder Set with Holder/Heating Block Avanti Polar Lipids Cat# 610000-1EA Syringe (1000 mL) Avanti Polar Lipids Cat# 610017-1EA Uranyl Acetate 98%, ACS Reagent Polysciences, Inc Cat# 21447-25 Superdex 200 Increase 10/300 GL Cytiva Cat# GE28-9909-44 EM grid (Carbon film 300 mesh, Copper) Electron Microscopy Sciences Cat# CF300-CU EM grid (Quantifoil R 1.2/1.3 300 Mesh, Copper) Electron Microscopy Sciences Cat# Q3100CR1.3 Quantifoil R 1.2/1.3, UT, 300 Mesh, Copper Electron Microscopy Sciences Cat# Q3100CR1.3-2nm Oligonucleotides HlgA_NcoI_FP: 50CATGCCATGGATATG GAGAACAAAATCGAAGACA-30 This study N/A HlgA_XhoI_RP: 50CCGCTCGAGCTTCG GGGTAATGCTTTTGATCTTA-30 This study N/A HlgB_NcoI_FP: 50CATGCCATGGATATGGAGGGCAA GATCACCCCG-30 This study N/A HlgB_XhoI_RP: 50CCGCTCGAGTTTGTTGTTTTCGGTC TCCTTGGTATCCAGCAG-30 This study N/A Recombinant DNA pET-26(b)+ Vector Novagen Addgene plasmid 2563 Gamma Hemolysin component A (codon optimized) Genscript, USA N/A Gamma Hemolysin component B (codon optimized) Genscript, USA N/A Software and algorithms EMAN 2.1 Tang et. al., 200755 https://blake.bcm.edu/emanwiki/EMAN2 SIMPLE 1 Elmlund and Elmlund, 201257 https://simplecryoem.com/SIMPLE3.0/ old_pages/1.0/index.html (Continued on next page) e1 Structure 31, 651–667.e1–e5, June 1, 2023

    Software:

    Article Title: Protocol to engineer nanofilms embedded lipid nanoparticles for controlled and targeted drug delivery (NECTAR).
    Article Snippet: 15,000–30,000) MilliporeSigma Cat# 26124-78-7 y(sodium 4-styrene sulfonate) (SPS) (M.W. .. 70,000) MilliporeSigma Cat# 25704-18-1 (Continued on next page) STAR Protocols 4, 101685, March 17, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Hyaluronic acid (HA) MilliporeSigma Cat# 53747 1, 2- Dipalmitoyl-sn-glycero-3phopshoethanolamine (DPPE) MilliporeSigma Cat# P1348 Cholesterol (CHOL) MilliporeSigma Cat# C8667 1-ethyl-3-(3-dimethylaminopropyl) carbomiide (EDAC) MilliporeSigma Cat# 341006 L a-Phosphatidylcholine (PC) MilliporeSigma Cat# P3556 TopFluor cholesterol Avanti Polar Lipids Cat# 810255 Boric acid (H3BO3) Sigma-Aldrich Cat# B6768 Glacial acetic acid (CH3COOH) Sigma-Aldrich Cat# PHR1748 HEPES free acid (C8H18N2O4S) Sigma-Aldrich Cat# 391338 Sodium acetate (CH3COONa) Sigma-Aldrich Cat# S2889 Sodium chloride (NaCl) Sigma-Aldrich Cat# S9888 Potassium chloride (KCl) Sigma-Aldrich Cat# P3911 Sodium phosphate dibasic (Na2HPO4) Sigma-Aldrich Cat# 94046 Potassium phosphate monobasic (KH2PO4) Sigma-Aldrich Cat# P8709 MES (2-[morpholino]ethanesulfonic acid) Sigma-Aldrich Cat# M3671 Hydroxylamine-HCl Thermo Fisher Scientific Cat# 26103 Sulfo-NHS (N-hydroxysulfosuccinimide) Thermo Fisher Scientific Cat# 24510 100% Pure ethanol (200 Proof) Decon Labs Cat# 2701 Software and algorithms ImageJ N/A N/A Photoshop N/A N/A Biorender N/A N/A Other Syringe Sigma-Aldrich Cat# Z116866-100EA Syringe filter Sigma-Aldrich Cat# WHA10462200 Mini extruder apparatus Avanti Polar Lipids Cat# 610020 Polycarbonate membranes 0.8 mm Avanti Polar Lipids Cat# 610009 Polycarbonate membranes 0.4 mm Avanti Polar Lipids Cat# 610007 Polycarbonate membranes 0.2 mm Avanti Polar Lipids Cat# 610006 Polycarbonate membranes 0.08 mm Avanti Polar Lipids Cat# 610005 Filter supports Avanti Polar Lipids Cat# 610014 Heating plate (model: Isotemp) Fisher Scientific N/A Ultracentrifuge (model: Optima Max-XP) Beckman Coulter Life Sciences Cat# 393315 Ultracentrifuge rotor (model: TLA-100.3) Beckman Coulter Life Sciences Cat# 349490 Ultracentrifuge tubes (3.5 mL tubes for TLA-100.3 rotor) Beckman Coulter Life Sciences Cat# 349622 Rotary evaporator (model: Rotavapor R-124) BUCHI Cat# R-124 Inverted microscope (model: Axiovert 40 CFL) ZEISS N/A Microscope camera (model: ProgRes C3) Jenoptik N/A Plasma cleaner (model: High Power Expanded Plasma Cleaner) Harrick Plasma Cat# PDC-001-HP Ultrasonic bath (model: FS30D Ultrasonic Cleaner) Fisher Scientific N/A Vortex (model: Maxi Mix II Vortex Mixer) Fisher Scientific Cat# NC0453190 ll OPEN ACCESSProtocol ..

    Inverted Microscopy:

    Article Title: Protocol to engineer nanofilms embedded lipid nanoparticles for controlled and targeted drug delivery (NECTAR).
    Article Snippet: 15,000–30,000) MilliporeSigma Cat# 26124-78-7 y(sodium 4-styrene sulfonate) (SPS) (M.W. .. 70,000) MilliporeSigma Cat# 25704-18-1 (Continued on next page) STAR Protocols 4, 101685, March 17, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Hyaluronic acid (HA) MilliporeSigma Cat# 53747 1, 2- Dipalmitoyl-sn-glycero-3phopshoethanolamine (DPPE) MilliporeSigma Cat# P1348 Cholesterol (CHOL) MilliporeSigma Cat# C8667 1-ethyl-3-(3-dimethylaminopropyl) carbomiide (EDAC) MilliporeSigma Cat# 341006 L a-Phosphatidylcholine (PC) MilliporeSigma Cat# P3556 TopFluor cholesterol Avanti Polar Lipids Cat# 810255 Boric acid (H3BO3) Sigma-Aldrich Cat# B6768 Glacial acetic acid (CH3COOH) Sigma-Aldrich Cat# PHR1748 HEPES free acid (C8H18N2O4S) Sigma-Aldrich Cat# 391338 Sodium acetate (CH3COONa) Sigma-Aldrich Cat# S2889 Sodium chloride (NaCl) Sigma-Aldrich Cat# S9888 Potassium chloride (KCl) Sigma-Aldrich Cat# P3911 Sodium phosphate dibasic (Na2HPO4) Sigma-Aldrich Cat# 94046 Potassium phosphate monobasic (KH2PO4) Sigma-Aldrich Cat# P8709 MES (2-[morpholino]ethanesulfonic acid) Sigma-Aldrich Cat# M3671 Hydroxylamine-HCl Thermo Fisher Scientific Cat# 26103 Sulfo-NHS (N-hydroxysulfosuccinimide) Thermo Fisher Scientific Cat# 24510 100% Pure ethanol (200 Proof) Decon Labs Cat# 2701 Software and algorithms ImageJ N/A N/A Photoshop N/A N/A Biorender N/A N/A Other Syringe Sigma-Aldrich Cat# Z116866-100EA Syringe filter Sigma-Aldrich Cat# WHA10462200 Mini extruder apparatus Avanti Polar Lipids Cat# 610020 Polycarbonate membranes 0.8 mm Avanti Polar Lipids Cat# 610009 Polycarbonate membranes 0.4 mm Avanti Polar Lipids Cat# 610007 Polycarbonate membranes 0.2 mm Avanti Polar Lipids Cat# 610006 Polycarbonate membranes 0.08 mm Avanti Polar Lipids Cat# 610005 Filter supports Avanti Polar Lipids Cat# 610014 Heating plate (model: Isotemp) Fisher Scientific N/A Ultracentrifuge (model: Optima Max-XP) Beckman Coulter Life Sciences Cat# 393315 Ultracentrifuge rotor (model: TLA-100.3) Beckman Coulter Life Sciences Cat# 349490 Ultracentrifuge tubes (3.5 mL tubes for TLA-100.3 rotor) Beckman Coulter Life Sciences Cat# 349622 Rotary evaporator (model: Rotavapor R-124) BUCHI Cat# R-124 Inverted microscope (model: Axiovert 40 CFL) ZEISS N/A Microscope camera (model: ProgRes C3) Jenoptik N/A Plasma cleaner (model: High Power Expanded Plasma Cleaner) Harrick Plasma Cat# PDC-001-HP Ultrasonic bath (model: FS30D Ultrasonic Cleaner) Fisher Scientific N/A Vortex (model: Maxi Mix II Vortex Mixer) Fisher Scientific Cat# NC0453190 ll OPEN ACCESSProtocol ..



    Similar Products

    filter supports avanti polar lipids  (Croda International Plc)
    94
    Croda International Plc filter supports avanti polar lipids
    Filter Supports Avanti Polar Lipids, supplied by Croda International Plc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/filter+supports+avanti+polar+lipids/Filter+Support/pm41790551-187-141-143
    Average 94 stars, based on 1 article reviews
    filter supports avanti polar lipids - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    nylon filter support avanti polar lipids  (Croda International Plc)
    94
    Croda International Plc nylon filter support avanti polar lipids
    Nylon Filter Support Avanti Polar Lipids, supplied by Croda International Plc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/filter+supports+avanti+polar+lipids/Filter+Support/pm41790557-251-15-18
    Average 94 stars, based on 1 article reviews
    nylon filter support avanti polar lipids - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier
    lipids 610010 filter supports avanti polar lipids 610014 slide a lyzertm dialysis cassettes  (Croda International Plc)
    96
    Croda International Plc lipids 610010 filter supports avanti polar lipids 610014 slide a lyzertm dialysis cassettes
    Lipids 610010 Filter Supports Avanti Polar Lipids 610014 Slide A Lyzertm Dialysis Cassettes, supplied by Croda International Plc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/filter+supports+avanti+polar+lipids/PC+Membranes/pmc06739424__mmc3-305-175-179
    Average 96 stars, based on 1 article reviews
    lipids 610010 filter supports avanti polar lipids 610014 slide a lyzertm dialysis cassettes - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    avanti polar lipids cat  (Croda International Plc)
    94
    Croda International Plc avanti polar lipids cat
    Avanti Polar Lipids Cat, supplied by Croda International Plc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/filter+supports+avanti+polar+lipids/Filter+Support/10__1038_slash_nprot__2015__054-145-22-22
    Average 94 stars, based on 1 article reviews
    avanti polar lipids cat - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results